Review



akt  (Cell Signaling Technology Inc)


Bioz Verified Symbol Cell Signaling Technology Inc is a verified supplier
Bioz Manufacturer Symbol Cell Signaling Technology Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    Cell Signaling Technology Inc akt
    PC capsules promoted diabetes skin wound healing via <t>activating</t> <t>PI3K/AKT</t> signaling pathway: (A) top 20 KEGG pathway (signal transduction) analysis of differential genes between control group and PC capsule treatment group; (B) gene set enrichment analysis of regulated gene pathways with KEGG and Genomes databases; (C–E) IHC results showing increase in expression of p-PI3K in PC capsule group. Data are presented as mean ± standard deviation (SD) with n = 3 independent biological replicates per group. Statistical analysis was performed using one-way ANOVA followed by Tukey's post-hoc test. Significance markers are defined as: #p < 0.05 (vs control group); ∗p < 0.05, ∗∗p < 0.01 (vs PC group).
    Akt, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 2281 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/2920s/Akt+(pan)+Mouse+mAb/pmc13022637-139-33-35
    Average 96 stars, based on 2281 article reviews
    akt - by Bioz Stars, 2026-10
    96/100 stars

    Images

    1) Product Images from "Procyanidin capsules attenuate PI3K/AKT-mediated mitochondrial dysfunction and accelerate skin wound healing in diabetic mice"

    Article Title: Procyanidin capsules attenuate PI3K/AKT-mediated mitochondrial dysfunction and accelerate skin wound healing in diabetic mice

    Journal: Materials Today Bio

    doi: 10.1016/j.mtbio.2026.103029

    PC capsules promoted diabetes skin wound healing via activating PI3K/AKT signaling pathway: (A) top 20 KEGG pathway (signal transduction) analysis of differential genes between control group and PC capsule treatment group; (B) gene set enrichment analysis of regulated gene pathways with KEGG and Genomes databases; (C–E) IHC results showing increase in expression of p-PI3K in PC capsule group. Data are presented as mean ± standard deviation (SD) with n = 3 independent biological replicates per group. Statistical analysis was performed using one-way ANOVA followed by Tukey's post-hoc test. Significance markers are defined as: #p < 0.05 (vs control group); ∗p < 0.05, ∗∗p < 0.01 (vs PC group).
    Figure Legend Snippet: PC capsules promoted diabetes skin wound healing via activating PI3K/AKT signaling pathway: (A) top 20 KEGG pathway (signal transduction) analysis of differential genes between control group and PC capsule treatment group; (B) gene set enrichment analysis of regulated gene pathways with KEGG and Genomes databases; (C–E) IHC results showing increase in expression of p-PI3K in PC capsule group. Data are presented as mean ± standard deviation (SD) with n = 3 independent biological replicates per group. Statistical analysis was performed using one-way ANOVA followed by Tukey's post-hoc test. Significance markers are defined as: #p < 0.05 (vs control group); ∗p < 0.05, ∗∗p < 0.01 (vs PC group).

    Techniques Used: Capsules, Transduction, Control, Expressing, Standard Deviation

    PC capsule–mediated cytoprotection via promoting activation of PI3K/AKT signaling pathway: expression of p-PI3K, PI3K, p-AKT, and AKT in HUVECs treated with PC capsules for 24 h and presence/absence of H 2 O 2 for 6 h (A); and analysis of optical density values of p-PI3K/PI3K (B) and p-AKT/AKT (C); expression of p-PI3K, PI3K, p-AKT, and AKT in NIH/3T3 cells treated with PC capsules for 24 h and presence/absence of H 2 O 2 for 6 h (D); and analysis of optical density values of p-PI3K/PI3K (E) and p-AKT/AKT (F). Data are presented as mean ± standard deviation (SD) with n = 3 independent biological replicates per group. Statistical analysis was performed using one-way ANOVA followed by Tukey's post-hoc test. Significance markers are defined as: #p < 0.05, ##p < 0.01, ###p < 0.001 (vs control group); ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001 (vs PC group or vs H 2 O 2 group).
    Figure Legend Snippet: PC capsule–mediated cytoprotection via promoting activation of PI3K/AKT signaling pathway: expression of p-PI3K, PI3K, p-AKT, and AKT in HUVECs treated with PC capsules for 24 h and presence/absence of H 2 O 2 for 6 h (A); and analysis of optical density values of p-PI3K/PI3K (B) and p-AKT/AKT (C); expression of p-PI3K, PI3K, p-AKT, and AKT in NIH/3T3 cells treated with PC capsules for 24 h and presence/absence of H 2 O 2 for 6 h (D); and analysis of optical density values of p-PI3K/PI3K (E) and p-AKT/AKT (F). Data are presented as mean ± standard deviation (SD) with n = 3 independent biological replicates per group. Statistical analysis was performed using one-way ANOVA followed by Tukey's post-hoc test. Significance markers are defined as: #p < 0.05, ##p < 0.01, ###p < 0.001 (vs control group); ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001 (vs PC group or vs H 2 O 2 group).

    Techniques Used: Activation Assay, Expressing, Capsules, Standard Deviation, Control

    PC capsules improve HUVEC and NIH/3T3 cell dysfunction by regulating PI3K/AKT signaling. HUVECs and NIH/3T3 cells were treated with PC capsules and LY294002 for 24 h and H 2 O 2 for 6 h. (A) Images of HUVEC migration exposure to H 2 O 2 , LY294002, PC capsules after 24 h; (B) quantification of percentage wound area remaining for HUVECs; (C) images of NIH/3T3 cell migration exposure to H 2 O 2 , LY294002, PC capsules after 24 h; (D) quantification of percentage wound area remaining for NIH/3T3 cells; (E–F) digital images of endothelial cell microtubule formation after treatment with H 2 O 2 , LY294002, and PC capsules. Quantification of (G) number of branch sites, (H) total lengths and (I) numbers of tube nodes (J); and analysis of optical density values of p-PI3K/PI3K (K) and p-AKT/AKT (L); expression of p-PI3K, PI3K, p-AKT, and AKT in NIH/3T3 cells treated with PC capsules, and LY294002 for 24 h and presence/absence of H 2 O 2 for 6 h (M); and analysis of optical density values of p-PI3K/PI3K (N) and p-AKT/AKT (O). Data are presented as mean ± standard deviation (SD) with n = 3 independent biological replicates per group. Statistical analysis was performed using one-way ANOVA followed by Tukey's post-hoc test. Significance markers are defined as: ##p < 0.01, ###p < 0.001 (vs. control group); ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001 (vs PC group or vs LY294002 group).
    Figure Legend Snippet: PC capsules improve HUVEC and NIH/3T3 cell dysfunction by regulating PI3K/AKT signaling. HUVECs and NIH/3T3 cells were treated with PC capsules and LY294002 for 24 h and H 2 O 2 for 6 h. (A) Images of HUVEC migration exposure to H 2 O 2 , LY294002, PC capsules after 24 h; (B) quantification of percentage wound area remaining for HUVECs; (C) images of NIH/3T3 cell migration exposure to H 2 O 2 , LY294002, PC capsules after 24 h; (D) quantification of percentage wound area remaining for NIH/3T3 cells; (E–F) digital images of endothelial cell microtubule formation after treatment with H 2 O 2 , LY294002, and PC capsules. Quantification of (G) number of branch sites, (H) total lengths and (I) numbers of tube nodes (J); and analysis of optical density values of p-PI3K/PI3K (K) and p-AKT/AKT (L); expression of p-PI3K, PI3K, p-AKT, and AKT in NIH/3T3 cells treated with PC capsules, and LY294002 for 24 h and presence/absence of H 2 O 2 for 6 h (M); and analysis of optical density values of p-PI3K/PI3K (N) and p-AKT/AKT (O). Data are presented as mean ± standard deviation (SD) with n = 3 independent biological replicates per group. Statistical analysis was performed using one-way ANOVA followed by Tukey's post-hoc test. Significance markers are defined as: ##p < 0.01, ###p < 0.001 (vs. control group); ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001 (vs PC group or vs LY294002 group).

    Techniques Used: Capsules, Migration, Expressing, Standard Deviation, Control

    Related Articles

    Western Blot:

    Article Title: TRIM16 mediates secretory autophagy in head and neck cancer-associated fibroblasts
    Article Snippet: ACTA2/αSMA , Cell Signaling Technology 19,245 , IHC, 1:300. .. AKT1 , Cell Signaling Technology, 2920S , WB, 1:2000. .. pan-actin , Cell Signaling Technology 41,185 , WB, 1:5000.

    Article Title: PFKFB2 Is Pivotal for Metabolic Flexibility and Differential Glucose Utilization
    Article Snippet: .. Antibodies Used for Western Blot Analysis Antibody against Producer/product number Primary dilution Secondary dilution Akt Cell Signaling Technology (CST): 2920S 1:1000 1:3000 Phospho- Akt (serine 473) CST: 4060S 1:1000 1:3000 GFAT1 CST: 5322S 1:500 1:2000 OGA/MGEA5 Proteintech:14711- 1- AP 1:1000 1:3000 OGT Sigma: O6264 1:1000 1:3000 O- linked N- acetylglucosamine Rabbit mAb CST: 82332S 1:1000 1:3000 RL2 Novus: NB300- 524 1:500 (WB) 1:1000 (immunoprecipitation) 1:2000 (WB) 1:3000 (immunoprecipitation) PDH CST: 3205S 1:1000 1:3000 Phospho- PDH (serine 293) CST:31866S 1:1000 1:3000 PDK1 Enzo Life Sciences: ADI- KAP- PK112 1:250 1:2000 PDK2 Santa Cruz: sc- 100 534 1:500 1:2000 PDK4 Biosynthesis, Inc.19 1:750 1:3000 Sp1 Sigma: 07–645 1:1000 1:3000 Akt indicates protein kinase B; GFAT1, glutamine fructose 6- phosphate amidotransferase; OGA, O- GlcNAcase; OGT, O- GlcNAc transferase; PDH, pyruvate dehydrogenase; PDK, pyruvate dehydrogenase kinase; Sp1, specificity protein 1; and WB, western blot. ..

    Article Title: Loss of Cardiac PFKFB2 Drives Metabolic, Functional, and Electrophysiological Remodeling in the Heart
    Article Snippet: .. Antibodies Used for Western Blot Analysis Antibody Company/product number Primary dilution Secondary dilution Acetyl- CoA carboxylase (ACC) CST: 3676S 1:1000 1:2000 Phospho- ACC (Ser79) CST:3661S 1:1000 1:2000 Protein kinase B (Akt) CST: 2920S 1:1000 1:3000 Phospho- Akt (Ser473) CST: 4060S 1:1000 1:3000 AMP- activated protein kinase β1/2 (AMPKβ1/2) CST: 4150P 1:1000 1:5000 Phospho- AMPKβ1 (Ser108) CST: 4181P 1:1000 1:3000 Cytochrome c Bio- Synthesis40 1:1000 1:2000 Mitochondrial pyruvate carrier 2 (MPC2) CST: 46141S 1:1000 1:3000 O- linked N- acetylglucosamine CST:82332S 1:1000 1:2500 Phospho- PFKFB2 (Ser 483) CST: 13064S 1:1000 1:3000 Pyruvate dehydrogenase (PDH) CST: 3205S 1:1000 1:2000 Phospho- PDH (Ser293) CST:31866S 1:1000 1:2000 Translocase of the outer mitochondrial membrane (TOM20) CST: 42406S 1:1000 1:3000 CST indicates Cell Signaling Technology. ..

    Article Title: Human Disabled-2 regulates thromboxane A 2 signaling for efficient hemostasis in thrombocytopenia
    Article Snippet: .. Antibodies for Western blotting: Actin (AC-15), NB600-501, Novus Biologicals (https://www.novusbio.com/products/beta-actin-antibody-ac-15_nb600-501) Dab2 (p96), 610465, BD Transduction Laboratories (https://www.bdbiosciences.com/en-au/products/reagents/microscopy-imagingreagents/immunofluorescence-reagents/purified-mouse-anti-disabled-2-p96.610465) Dab2 (EP2297Y), ab76253, Abcam (https://www.abcam.com/products/primary-antibodies/dab2-antibody-ep2297y-ab76253.html) Recombinant Rabbit IgG, monoclonal [EPR25A] - Isotype Control, ab172730, Abcam (https://www.abcam.com/en-tw/products/ primary-antibodies/rabbit-igg-monoclonal-epr25a-isotype-control-ab172730) HA-Tag (6E2), 2367S, Cell Signaling (https://www.cellsignal.com/products/primary-antibodies/ha-tag-6e2-mouse-mab/2367) p-AKT (Ser473), AP0637, ABclonal (https://abclonal.com/catalog-antibodies/Phospho-Akt1-S473mAb/AP0637) AKT (pan) (C67E7), 4691X, Cell Signaling (https://www.cellsignal.com/products/primary-antibodies/akt-pan-c67e7-rabbit-mab/4691) AKT (pan) (40D4), 2920S, Cell Signaling (https://www.cellsignal.com/products/primary-antibodies/akt-pan-40d4-mouse-mab/2920) p-mTOR (Ser2481), 2974S, Cell Signaling (https://www.cellsignal.com/products/primary-antibodies/phospho-mtor-ser2481antibody/2974) Total mTOR, 2972S, Cell Signaling (https://www.cellsignal.com/products/primary-antibodies/mtor-antibody/2972) p-PLD1 (Thr147), 3831S, Cell Signaling (https://www.cellsignal.com/products/primary-antibodies/phospho-pld1-thr147antibody/3831) Total PLD1, 3832, Cell Signaling (https://www.cellsignal.com/products/primary-antibodies/pld1-antibody/3832) GST (B-14), sc-138, Santa Cruz Biotechnology (https://www.scbt.com/p/gst-antibody-b-14) Antibodies for flow cytometry: PE-conjugated anti-CD62P antibody (Psel.KO2.3), 12-0626-82, eBioscience (https://www.thermofisher.com/antibody/product/ CD62P-P-Selectin-Antibody-clone-Psel-KO2-3-Monoclonal/12-0626-82) PE-conjugated mouse IgG1 kappa Isotype Control (P3.6.2.8.1), 12-4714-82, eBioscience (https://www.thermofisher.com/antibody/ product/Mouse-IgG1-kappa-clone-P3-6-2-8-1-Monoclonal/12-4714-82) Alexa Fluor 488-conjugated fibrinogen, F13191, Invitrogen (https://www.thermofisher.com/order/catalog/product/F13191) FITC-conjugated anti-TP receptor antibody, 10012559, Cayman Chemicals Co. (https://www.caymanchem.com/product/10012559/ 4 n atu re p o rtfo lio | rep o rtin g su m m ary A pril2023 Animals and other research organisms Policy information about studies involving animals; ARRIVE guidelines recommended for reporting animal research, and Sex and Gender in Research Laboratory animals Wild animals Reporting on sex Field-collected samples Ethics oversight Note that full information on the approval of the study protocol must also be provided in the manuscript. ..

    Article Title: Human Disabled-2 regulates thromboxane A 2 signaling for efficient hemostasis in thrombocytopenia
    Article Snippet: .. Antibodies for Western blotting: (Antibody, Clone number (if applicable), Cat no, Supplier) Actin (AC-15), NB600-501, Novus Biologicals Dab2 (p96), 610465, BD Transduction Laboratories Dab2 (EP2297Y), ab76253, Abcam Recombinant Rabbit IgG, monoclonal [EPR25A] - Isotype Control, ab172730, Abcam HA-Tag (6E2), 2367S, Cell Signaling p-AKT (Ser473), AP0637, ABclonal AKT (pan) (C67E7), 4691X, Cell Signaling AKT (pan) (40D4), 2920S, Cell Signaling p-mTOR (Ser2481), 2974S, Cell Signaling Total mTOR, 2972S, Cell Signaling p-PLD1 (Thr147), 3831S, Cell Signaling Total PLD1, 3832, Cell Signaling GST (B-14), sc-138, Santa Cruz Biotechnology Antibodies for flow cytometry: (Antibody, Clone number (if applicable), Cat no, Supplier) PE-conjugated anti-CD62P antibody (Psel.KO2.3), 12-0626-82, eBioscience PE-conjugated mouse IgG1 kappa Isotype Control (P3.6.2.8.1), 12-4714-82, eBioscience Alexa Fluor 488-conjugated fibrinogen, F13191, Invitrogen FITC-conjugated anti-TP receptor antibody, 10012559, Cayman Chemicals Co. FITC-conjugated Normal Rabbit IgG, 10010322, Cayman Chemicals Co. All antibodies used in this study are commercially available and were validated by the manufacturer. ..

    Immunoprecipitation:

    Article Title: PFKFB2 Is Pivotal for Metabolic Flexibility and Differential Glucose Utilization
    Article Snippet: .. Antibodies Used for Western Blot Analysis Antibody against Producer/product number Primary dilution Secondary dilution Akt Cell Signaling Technology (CST): 2920S 1:1000 1:3000 Phospho- Akt (serine 473) CST: 4060S 1:1000 1:3000 GFAT1 CST: 5322S 1:500 1:2000 OGA/MGEA5 Proteintech:14711- 1- AP 1:1000 1:3000 OGT Sigma: O6264 1:1000 1:3000 O- linked N- acetylglucosamine Rabbit mAb CST: 82332S 1:1000 1:3000 RL2 Novus: NB300- 524 1:500 (WB) 1:1000 (immunoprecipitation) 1:2000 (WB) 1:3000 (immunoprecipitation) PDH CST: 3205S 1:1000 1:3000 Phospho- PDH (serine 293) CST:31866S 1:1000 1:3000 PDK1 Enzo Life Sciences: ADI- KAP- PK112 1:250 1:2000 PDK2 Santa Cruz: sc- 100 534 1:500 1:2000 PDK4 Biosynthesis, Inc.19 1:750 1:3000 Sp1 Sigma: 07–645 1:1000 1:3000 Akt indicates protein kinase B; GFAT1, glutamine fructose 6- phosphate amidotransferase; OGA, O- GlcNAcase; OGT, O- GlcNAc transferase; PDH, pyruvate dehydrogenase; PDK, pyruvate dehydrogenase kinase; Sp1, specificity protein 1; and WB, western blot. ..

    Membrane:

    Article Title: Loss of Cardiac PFKFB2 Drives Metabolic, Functional, and Electrophysiological Remodeling in the Heart
    Article Snippet: .. Antibodies Used for Western Blot Analysis Antibody Company/product number Primary dilution Secondary dilution Acetyl- CoA carboxylase (ACC) CST: 3676S 1:1000 1:2000 Phospho- ACC (Ser79) CST:3661S 1:1000 1:2000 Protein kinase B (Akt) CST: 2920S 1:1000 1:3000 Phospho- Akt (Ser473) CST: 4060S 1:1000 1:3000 AMP- activated protein kinase β1/2 (AMPKβ1/2) CST: 4150P 1:1000 1:5000 Phospho- AMPKβ1 (Ser108) CST: 4181P 1:1000 1:3000 Cytochrome c Bio- Synthesis40 1:1000 1:2000 Mitochondrial pyruvate carrier 2 (MPC2) CST: 46141S 1:1000 1:3000 O- linked N- acetylglucosamine CST:82332S 1:1000 1:2500 Phospho- PFKFB2 (Ser 483) CST: 13064S 1:1000 1:3000 Pyruvate dehydrogenase (PDH) CST: 3205S 1:1000 1:2000 Phospho- PDH (Ser293) CST:31866S 1:1000 1:2000 Translocase of the outer mitochondrial membrane (TOM20) CST: 42406S 1:1000 1:3000 CST indicates Cell Signaling Technology. ..

    Recombinant:

    Article Title: Hippocampal astrocytes induce sex-dimorphic effects on memory.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-HA Biolegend Cat # 901513; RRID: AB_2565335 Rabbit anti-HA Cell Signaling Cat # 3724S; RRID: AB_1549585 Rabbit anti-GFAP MilliporeSigma Cat # G9269; RRID: AB_477035 Mouse anti-GFAP MilliporeSigma Cat # MAB3402B; RRID: AB_10917109 Goat anti-GFAP Abcam Cat # ab53554; RRID: AB_880202 Chicken anti-GFAP Abcam Cat # ab4674; RRID: AB_304558 Rabbit anti-mGluR3 Abcam Cat # ab166608; RRID: AB_2833092 Chicken anti-GFP Abcam Cat # ab13970; RRID: AB_300798 Rabbit anti-NeuN MilliporeSigma Cat # ABN78; RRID: AB_10807945 Guinea pig anti-NeuN MilliporeSigma Cat # ABN90; RRID: AB_11205592 Goat anti-Iba1 Abcam Cat # ab5076; RRID: AB_222402 Rabbit anti-phospho-CREB (S133) Cell Signaling Cat # 9198; RRID: AB_2561044 Mouse anti-total-CREB Cell Signaling Cat # 9104S; RRID: AB_490881 Rabbit anti-phospho-Akt (Ser473) Abcam Cat # ab81283; RRID: AB_2224551 Mouse anti-total-Akt Cell Signaling Cat # 2920S; RRID: AB_1147620 Mouse anti-g-tubulin MilliporeSigma Cat # T5326; RRID: AB_532292 Mouse anti-c-Fos Abcam Cat # ab208942; RRID: AB_2747772 Bacterial and viral strains AAV2/PHP.eB-U6-sgRNA552 In paper N/A AAV2/PHP.eB-U6-sgRNA703 In paper N/A AAV2/PHP.eB-hGfaABC1D-DIO-HA-mGluR3 In paper N/A AAV2/PHP.eB-hGfaABC1D-DIO-HA-hM4Di In paper N/A AAV2/PHP.eB-hGfaABC1D-DIO-HA-rM3Ds In paper N/A Chemicals, peptides, and recombinant proteins Clozapine-N-oxide Tocris Cat # 4936 LY354740 Tocris Cat # 3246 2,2,2-tribromoethanol Fisher Scientific Cat # AC421430100 40,6-Diamidino-2-phenylindole dihydrochloride (DAPI) MilliporeSigma Cat # D9542 Tamoxifen (TAM) MilliporeSigma Cat # T5648 Critical commercial assays Platinum SuperFi DNA Polymerase kit ThermoFisher Cat #12351010 Plasmid Plus Maxi Prep kit Qiagen Cat # 12963 RNeasy Mini Kit with DNase Qiagen Cat # 74106; # 79256 Protoscript First Strand Synthesis Kit New England Biolabs Cat # 6300L Experimental models: Cell lines NEB 5-alpha competent bacteria New England Biolabs Cat # C2987H Experimental models: Organisms/strains Aldh1l1-CreERT2 mice (12–14 months of age) Jackson Laboratory Strain 031008 Rosa26-LSL-Cas9 mice (used in crossing lines; up to 12 months of age) Jackson Laboratory Strain 026556 (Continued on next page) 14 Cell Reports 43, 114278, June 25, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Aldh1l1-Cre mice (4–7 months of age) Jackson Laboratory Strain 023748 Aldh1l1-CreERT2 x Rosa26-LSL-Cas9 (Aldh1l1-Cas9) mice; 5–7 months of age) This paper N/A Wild-type C57BL/6J mice (up to 12 months of age) Jackson Laboratory Strain 000664 Oligonucleotides #552 forward, CACCGCAGAGGTATCCAACGCCTGG This paper N/A #552 reverse, AAACCCAGGCGTTGGATACCTCTGC This paper N/A #703 forward, CCGCAGAGCATCGTTGACTAAAG This paper N/A #703 reverse, AACCTTTAGTCAACGATGCTCTGC This paper N/A See Table S4 for RT-qPCR primer sequences This paper N/A Recombinant DNA pAAV-U6-sgRNA-hSyn-mCherry vector Addgene; Hung et al.103 Addgene #87916; RRID: Addgene 87916 pAAV-GFAP-EGFP Addgene Addgene #50473; RRID: Addgene_50473 pAAV-EF1a-DIO-hM4D(Gi)-mCherry Addgene Addgene #50461; RRID: Addgene_50461 pCRII-TOPO CMV-cGFP-bGH Poly(A) Addgene; Wilusz et al.104 Addgene #46835; RRID: Addgene_46835 pAAV-GFAP-HA-hM4D(Gi)-IRES-mCitrine Addgene Addgene #50471; RRID: Addgene_50471 pAAV-GFAP-HA-rM3D(Gs)-IRES-mCitrine Addgene Addgene #50472; RRID: Addgene_50472 Software and algorithms Ethovision XT (version 12.0.1138) Noldus N/A R Studio (version 4.0.3) N/A Rtrack package (version 1.0.0) Overall et al.40 https://rupertoverall.net/Rtrack/ GraphPad Prism (version 8 or above) N/A BZ-X Analyzer Software Keyence N/A ImageJ (FIJI) N/A

    Article Title: Human Disabled-2 regulates thromboxane A 2 signaling for efficient hemostasis in thrombocytopenia
    Article Snippet: .. Antibodies for Western blotting: Actin (AC-15), NB600-501, Novus Biologicals (https://www.novusbio.com/products/beta-actin-antibody-ac-15_nb600-501) Dab2 (p96), 610465, BD Transduction Laboratories (https://www.bdbiosciences.com/en-au/products/reagents/microscopy-imagingreagents/immunofluorescence-reagents/purified-mouse-anti-disabled-2-p96.610465) Dab2 (EP2297Y), ab76253, Abcam (https://www.abcam.com/products/primary-antibodies/dab2-antibody-ep2297y-ab76253.html) Recombinant Rabbit IgG, monoclonal [EPR25A] - Isotype Control, ab172730, Abcam (https://www.abcam.com/en-tw/products/ primary-antibodies/rabbit-igg-monoclonal-epr25a-isotype-control-ab172730) HA-Tag (6E2), 2367S, Cell Signaling (https://www.cellsignal.com/products/primary-antibodies/ha-tag-6e2-mouse-mab/2367) p-AKT (Ser473), AP0637, ABclonal (https://abclonal.com/catalog-antibodies/Phospho-Akt1-S473mAb/AP0637) AKT (pan) (C67E7), 4691X, Cell Signaling (https://www.cellsignal.com/products/primary-antibodies/akt-pan-c67e7-rabbit-mab/4691) AKT (pan) (40D4), 2920S, Cell Signaling (https://www.cellsignal.com/products/primary-antibodies/akt-pan-40d4-mouse-mab/2920) p-mTOR (Ser2481), 2974S, Cell Signaling (https://www.cellsignal.com/products/primary-antibodies/phospho-mtor-ser2481antibody/2974) Total mTOR, 2972S, Cell Signaling (https://www.cellsignal.com/products/primary-antibodies/mtor-antibody/2972) p-PLD1 (Thr147), 3831S, Cell Signaling (https://www.cellsignal.com/products/primary-antibodies/phospho-pld1-thr147antibody/3831) Total PLD1, 3832, Cell Signaling (https://www.cellsignal.com/products/primary-antibodies/pld1-antibody/3832) GST (B-14), sc-138, Santa Cruz Biotechnology (https://www.scbt.com/p/gst-antibody-b-14) Antibodies for flow cytometry: PE-conjugated anti-CD62P antibody (Psel.KO2.3), 12-0626-82, eBioscience (https://www.thermofisher.com/antibody/product/ CD62P-P-Selectin-Antibody-clone-Psel-KO2-3-Monoclonal/12-0626-82) PE-conjugated mouse IgG1 kappa Isotype Control (P3.6.2.8.1), 12-4714-82, eBioscience (https://www.thermofisher.com/antibody/ product/Mouse-IgG1-kappa-clone-P3-6-2-8-1-Monoclonal/12-4714-82) Alexa Fluor 488-conjugated fibrinogen, F13191, Invitrogen (https://www.thermofisher.com/order/catalog/product/F13191) FITC-conjugated anti-TP receptor antibody, 10012559, Cayman Chemicals Co. (https://www.caymanchem.com/product/10012559/ 4 n atu re p o rtfo lio | rep o rtin g su m m ary A pril2023 Animals and other research organisms Policy information about studies involving animals; ARRIVE guidelines recommended for reporting animal research, and Sex and Gender in Research Laboratory animals Wild animals Reporting on sex Field-collected samples Ethics oversight Note that full information on the approval of the study protocol must also be provided in the manuscript. ..

    Article Title: Human Disabled-2 regulates thromboxane A 2 signaling for efficient hemostasis in thrombocytopenia
    Article Snippet: .. Antibodies for Western blotting: (Antibody, Clone number (if applicable), Cat no, Supplier) Actin (AC-15), NB600-501, Novus Biologicals Dab2 (p96), 610465, BD Transduction Laboratories Dab2 (EP2297Y), ab76253, Abcam Recombinant Rabbit IgG, monoclonal [EPR25A] - Isotype Control, ab172730, Abcam HA-Tag (6E2), 2367S, Cell Signaling p-AKT (Ser473), AP0637, ABclonal AKT (pan) (C67E7), 4691X, Cell Signaling AKT (pan) (40D4), 2920S, Cell Signaling p-mTOR (Ser2481), 2974S, Cell Signaling Total mTOR, 2972S, Cell Signaling p-PLD1 (Thr147), 3831S, Cell Signaling Total PLD1, 3832, Cell Signaling GST (B-14), sc-138, Santa Cruz Biotechnology Antibodies for flow cytometry: (Antibody, Clone number (if applicable), Cat no, Supplier) PE-conjugated anti-CD62P antibody (Psel.KO2.3), 12-0626-82, eBioscience PE-conjugated mouse IgG1 kappa Isotype Control (P3.6.2.8.1), 12-4714-82, eBioscience Alexa Fluor 488-conjugated fibrinogen, F13191, Invitrogen FITC-conjugated anti-TP receptor antibody, 10012559, Cayman Chemicals Co. FITC-conjugated Normal Rabbit IgG, 10010322, Cayman Chemicals Co. All antibodies used in this study are commercially available and were validated by the manufacturer. ..

    Plasmid Preparation:

    Article Title: Hippocampal astrocytes induce sex-dimorphic effects on memory.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-HA Biolegend Cat # 901513; RRID: AB_2565335 Rabbit anti-HA Cell Signaling Cat # 3724S; RRID: AB_1549585 Rabbit anti-GFAP MilliporeSigma Cat # G9269; RRID: AB_477035 Mouse anti-GFAP MilliporeSigma Cat # MAB3402B; RRID: AB_10917109 Goat anti-GFAP Abcam Cat # ab53554; RRID: AB_880202 Chicken anti-GFAP Abcam Cat # ab4674; RRID: AB_304558 Rabbit anti-mGluR3 Abcam Cat # ab166608; RRID: AB_2833092 Chicken anti-GFP Abcam Cat # ab13970; RRID: AB_300798 Rabbit anti-NeuN MilliporeSigma Cat # ABN78; RRID: AB_10807945 Guinea pig anti-NeuN MilliporeSigma Cat # ABN90; RRID: AB_11205592 Goat anti-Iba1 Abcam Cat # ab5076; RRID: AB_222402 Rabbit anti-phospho-CREB (S133) Cell Signaling Cat # 9198; RRID: AB_2561044 Mouse anti-total-CREB Cell Signaling Cat # 9104S; RRID: AB_490881 Rabbit anti-phospho-Akt (Ser473) Abcam Cat # ab81283; RRID: AB_2224551 Mouse anti-total-Akt Cell Signaling Cat # 2920S; RRID: AB_1147620 Mouse anti-g-tubulin MilliporeSigma Cat # T5326; RRID: AB_532292 Mouse anti-c-Fos Abcam Cat # ab208942; RRID: AB_2747772 Bacterial and viral strains AAV2/PHP.eB-U6-sgRNA552 In paper N/A AAV2/PHP.eB-U6-sgRNA703 In paper N/A AAV2/PHP.eB-hGfaABC1D-DIO-HA-mGluR3 In paper N/A AAV2/PHP.eB-hGfaABC1D-DIO-HA-hM4Di In paper N/A AAV2/PHP.eB-hGfaABC1D-DIO-HA-rM3Ds In paper N/A Chemicals, peptides, and recombinant proteins Clozapine-N-oxide Tocris Cat # 4936 LY354740 Tocris Cat # 3246 2,2,2-tribromoethanol Fisher Scientific Cat # AC421430100 40,6-Diamidino-2-phenylindole dihydrochloride (DAPI) MilliporeSigma Cat # D9542 Tamoxifen (TAM) MilliporeSigma Cat # T5648 Critical commercial assays Platinum SuperFi DNA Polymerase kit ThermoFisher Cat #12351010 Plasmid Plus Maxi Prep kit Qiagen Cat # 12963 RNeasy Mini Kit with DNase Qiagen Cat # 74106; # 79256 Protoscript First Strand Synthesis Kit New England Biolabs Cat # 6300L Experimental models: Cell lines NEB 5-alpha competent bacteria New England Biolabs Cat # C2987H Experimental models: Organisms/strains Aldh1l1-CreERT2 mice (12–14 months of age) Jackson Laboratory Strain 031008 Rosa26-LSL-Cas9 mice (used in crossing lines; up to 12 months of age) Jackson Laboratory Strain 026556 (Continued on next page) 14 Cell Reports 43, 114278, June 25, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Aldh1l1-Cre mice (4–7 months of age) Jackson Laboratory Strain 023748 Aldh1l1-CreERT2 x Rosa26-LSL-Cas9 (Aldh1l1-Cas9) mice; 5–7 months of age) This paper N/A Wild-type C57BL/6J mice (up to 12 months of age) Jackson Laboratory Strain 000664 Oligonucleotides #552 forward, CACCGCAGAGGTATCCAACGCCTGG This paper N/A #552 reverse, AAACCCAGGCGTTGGATACCTCTGC This paper N/A #703 forward, CCGCAGAGCATCGTTGACTAAAG This paper N/A #703 reverse, AACCTTTAGTCAACGATGCTCTGC This paper N/A See Table S4 for RT-qPCR primer sequences This paper N/A Recombinant DNA pAAV-U6-sgRNA-hSyn-mCherry vector Addgene; Hung et al.103 Addgene #87916; RRID: Addgene 87916 pAAV-GFAP-EGFP Addgene Addgene #50473; RRID: Addgene_50473 pAAV-EF1a-DIO-hM4D(Gi)-mCherry Addgene Addgene #50461; RRID: Addgene_50461 pCRII-TOPO CMV-cGFP-bGH Poly(A) Addgene; Wilusz et al.104 Addgene #46835; RRID: Addgene_46835 pAAV-GFAP-HA-hM4D(Gi)-IRES-mCitrine Addgene Addgene #50471; RRID: Addgene_50471 pAAV-GFAP-HA-rM3D(Gs)-IRES-mCitrine Addgene Addgene #50472; RRID: Addgene_50472 Software and algorithms Ethovision XT (version 12.0.1138) Noldus N/A R Studio (version 4.0.3) N/A Rtrack package (version 1.0.0) Overall et al.40 https://rupertoverall.net/Rtrack/ GraphPad Prism (version 8 or above) N/A BZ-X Analyzer Software Keyence N/A ImageJ (FIJI) N/A

    Bacteria:

    Article Title: Hippocampal astrocytes induce sex-dimorphic effects on memory.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-HA Biolegend Cat # 901513; RRID: AB_2565335 Rabbit anti-HA Cell Signaling Cat # 3724S; RRID: AB_1549585 Rabbit anti-GFAP MilliporeSigma Cat # G9269; RRID: AB_477035 Mouse anti-GFAP MilliporeSigma Cat # MAB3402B; RRID: AB_10917109 Goat anti-GFAP Abcam Cat # ab53554; RRID: AB_880202 Chicken anti-GFAP Abcam Cat # ab4674; RRID: AB_304558 Rabbit anti-mGluR3 Abcam Cat # ab166608; RRID: AB_2833092 Chicken anti-GFP Abcam Cat # ab13970; RRID: AB_300798 Rabbit anti-NeuN MilliporeSigma Cat # ABN78; RRID: AB_10807945 Guinea pig anti-NeuN MilliporeSigma Cat # ABN90; RRID: AB_11205592 Goat anti-Iba1 Abcam Cat # ab5076; RRID: AB_222402 Rabbit anti-phospho-CREB (S133) Cell Signaling Cat # 9198; RRID: AB_2561044 Mouse anti-total-CREB Cell Signaling Cat # 9104S; RRID: AB_490881 Rabbit anti-phospho-Akt (Ser473) Abcam Cat # ab81283; RRID: AB_2224551 Mouse anti-total-Akt Cell Signaling Cat # 2920S; RRID: AB_1147620 Mouse anti-g-tubulin MilliporeSigma Cat # T5326; RRID: AB_532292 Mouse anti-c-Fos Abcam Cat # ab208942; RRID: AB_2747772 Bacterial and viral strains AAV2/PHP.eB-U6-sgRNA552 In paper N/A AAV2/PHP.eB-U6-sgRNA703 In paper N/A AAV2/PHP.eB-hGfaABC1D-DIO-HA-mGluR3 In paper N/A AAV2/PHP.eB-hGfaABC1D-DIO-HA-hM4Di In paper N/A AAV2/PHP.eB-hGfaABC1D-DIO-HA-rM3Ds In paper N/A Chemicals, peptides, and recombinant proteins Clozapine-N-oxide Tocris Cat # 4936 LY354740 Tocris Cat # 3246 2,2,2-tribromoethanol Fisher Scientific Cat # AC421430100 40,6-Diamidino-2-phenylindole dihydrochloride (DAPI) MilliporeSigma Cat # D9542 Tamoxifen (TAM) MilliporeSigma Cat # T5648 Critical commercial assays Platinum SuperFi DNA Polymerase kit ThermoFisher Cat #12351010 Plasmid Plus Maxi Prep kit Qiagen Cat # 12963 RNeasy Mini Kit with DNase Qiagen Cat # 74106; # 79256 Protoscript First Strand Synthesis Kit New England Biolabs Cat # 6300L Experimental models: Cell lines NEB 5-alpha competent bacteria New England Biolabs Cat # C2987H Experimental models: Organisms/strains Aldh1l1-CreERT2 mice (12–14 months of age) Jackson Laboratory Strain 031008 Rosa26-LSL-Cas9 mice (used in crossing lines; up to 12 months of age) Jackson Laboratory Strain 026556 (Continued on next page) 14 Cell Reports 43, 114278, June 25, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Aldh1l1-Cre mice (4–7 months of age) Jackson Laboratory Strain 023748 Aldh1l1-CreERT2 x Rosa26-LSL-Cas9 (Aldh1l1-Cas9) mice; 5–7 months of age) This paper N/A Wild-type C57BL/6J mice (up to 12 months of age) Jackson Laboratory Strain 000664 Oligonucleotides #552 forward, CACCGCAGAGGTATCCAACGCCTGG This paper N/A #552 reverse, AAACCCAGGCGTTGGATACCTCTGC This paper N/A #703 forward, CCGCAGAGCATCGTTGACTAAAG This paper N/A #703 reverse, AACCTTTAGTCAACGATGCTCTGC This paper N/A See Table S4 for RT-qPCR primer sequences This paper N/A Recombinant DNA pAAV-U6-sgRNA-hSyn-mCherry vector Addgene; Hung et al.103 Addgene #87916; RRID: Addgene 87916 pAAV-GFAP-EGFP Addgene Addgene #50473; RRID: Addgene_50473 pAAV-EF1a-DIO-hM4D(Gi)-mCherry Addgene Addgene #50461; RRID: Addgene_50461 pCRII-TOPO CMV-cGFP-bGH Poly(A) Addgene; Wilusz et al.104 Addgene #46835; RRID: Addgene_46835 pAAV-GFAP-HA-hM4D(Gi)-IRES-mCitrine Addgene Addgene #50471; RRID: Addgene_50471 pAAV-GFAP-HA-rM3D(Gs)-IRES-mCitrine Addgene Addgene #50472; RRID: Addgene_50472 Software and algorithms Ethovision XT (version 12.0.1138) Noldus N/A R Studio (version 4.0.3) N/A Rtrack package (version 1.0.0) Overall et al.40 https://rupertoverall.net/Rtrack/ GraphPad Prism (version 8 or above) N/A BZ-X Analyzer Software Keyence N/A ImageJ (FIJI) N/A

    other:


    Article Title: Aminomethyl Salicylaldehydes Lock onto a Surface Lysine by Forming an Extended Intramolecular Hydrogen Bond Network.
    Article Snippet: Modified protein was buffer exchanged into 50 mM HEPES pH 8.0, 50 mM KCl, 1 mM DTT with 10% glycerol and concentrated to 20 mg/mL using a 10K MWCO filter (Millipore Amicon Ultra).

    Control:

    Article Title: Human Disabled-2 regulates thromboxane A 2 signaling for efficient hemostasis in thrombocytopenia
    Article Snippet: .. Antibodies for Western blotting: Actin (AC-15), NB600-501, Novus Biologicals (https://www.novusbio.com/products/beta-actin-antibody-ac-15_nb600-501) Dab2 (p96), 610465, BD Transduction Laboratories (https://www.bdbiosciences.com/en-au/products/reagents/microscopy-imagingreagents/immunofluorescence-reagents/purified-mouse-anti-disabled-2-p96.610465) Dab2 (EP2297Y), ab76253, Abcam (https://www.abcam.com/products/primary-antibodies/dab2-antibody-ep2297y-ab76253.html) Recombinant Rabbit IgG, monoclonal [EPR25A] - Isotype Control, ab172730, Abcam (https://www.abcam.com/en-tw/products/ primary-antibodies/rabbit-igg-monoclonal-epr25a-isotype-control-ab172730) HA-Tag (6E2), 2367S, Cell Signaling (https://www.cellsignal.com/products/primary-antibodies/ha-tag-6e2-mouse-mab/2367) p-AKT (Ser473), AP0637, ABclonal (https://abclonal.com/catalog-antibodies/Phospho-Akt1-S473mAb/AP0637) AKT (pan) (C67E7), 4691X, Cell Signaling (https://www.cellsignal.com/products/primary-antibodies/akt-pan-c67e7-rabbit-mab/4691) AKT (pan) (40D4), 2920S, Cell Signaling (https://www.cellsignal.com/products/primary-antibodies/akt-pan-40d4-mouse-mab/2920) p-mTOR (Ser2481), 2974S, Cell Signaling (https://www.cellsignal.com/products/primary-antibodies/phospho-mtor-ser2481antibody/2974) Total mTOR, 2972S, Cell Signaling (https://www.cellsignal.com/products/primary-antibodies/mtor-antibody/2972) p-PLD1 (Thr147), 3831S, Cell Signaling (https://www.cellsignal.com/products/primary-antibodies/phospho-pld1-thr147antibody/3831) Total PLD1, 3832, Cell Signaling (https://www.cellsignal.com/products/primary-antibodies/pld1-antibody/3832) GST (B-14), sc-138, Santa Cruz Biotechnology (https://www.scbt.com/p/gst-antibody-b-14) Antibodies for flow cytometry: PE-conjugated anti-CD62P antibody (Psel.KO2.3), 12-0626-82, eBioscience (https://www.thermofisher.com/antibody/product/ CD62P-P-Selectin-Antibody-clone-Psel-KO2-3-Monoclonal/12-0626-82) PE-conjugated mouse IgG1 kappa Isotype Control (P3.6.2.8.1), 12-4714-82, eBioscience (https://www.thermofisher.com/antibody/ product/Mouse-IgG1-kappa-clone-P3-6-2-8-1-Monoclonal/12-4714-82) Alexa Fluor 488-conjugated fibrinogen, F13191, Invitrogen (https://www.thermofisher.com/order/catalog/product/F13191) FITC-conjugated anti-TP receptor antibody, 10012559, Cayman Chemicals Co. (https://www.caymanchem.com/product/10012559/ 4 n atu re p o rtfo lio | rep o rtin g su m m ary A pril2023 Animals and other research organisms Policy information about studies involving animals; ARRIVE guidelines recommended for reporting animal research, and Sex and Gender in Research Laboratory animals Wild animals Reporting on sex Field-collected samples Ethics oversight Note that full information on the approval of the study protocol must also be provided in the manuscript. ..

    Article Title: Human Disabled-2 regulates thromboxane A 2 signaling for efficient hemostasis in thrombocytopenia
    Article Snippet: .. Antibodies for Western blotting: (Antibody, Clone number (if applicable), Cat no, Supplier) Actin (AC-15), NB600-501, Novus Biologicals Dab2 (p96), 610465, BD Transduction Laboratories Dab2 (EP2297Y), ab76253, Abcam Recombinant Rabbit IgG, monoclonal [EPR25A] - Isotype Control, ab172730, Abcam HA-Tag (6E2), 2367S, Cell Signaling p-AKT (Ser473), AP0637, ABclonal AKT (pan) (C67E7), 4691X, Cell Signaling AKT (pan) (40D4), 2920S, Cell Signaling p-mTOR (Ser2481), 2974S, Cell Signaling Total mTOR, 2972S, Cell Signaling p-PLD1 (Thr147), 3831S, Cell Signaling Total PLD1, 3832, Cell Signaling GST (B-14), sc-138, Santa Cruz Biotechnology Antibodies for flow cytometry: (Antibody, Clone number (if applicable), Cat no, Supplier) PE-conjugated anti-CD62P antibody (Psel.KO2.3), 12-0626-82, eBioscience PE-conjugated mouse IgG1 kappa Isotype Control (P3.6.2.8.1), 12-4714-82, eBioscience Alexa Fluor 488-conjugated fibrinogen, F13191, Invitrogen FITC-conjugated anti-TP receptor antibody, 10012559, Cayman Chemicals Co. FITC-conjugated Normal Rabbit IgG, 10010322, Cayman Chemicals Co. All antibodies used in this study are commercially available and were validated by the manufacturer. ..

    Flow Cytometry:

    Article Title: Human Disabled-2 regulates thromboxane A 2 signaling for efficient hemostasis in thrombocytopenia
    Article Snippet: .. Antibodies for Western blotting: Actin (AC-15), NB600-501, Novus Biologicals (https://www.novusbio.com/products/beta-actin-antibody-ac-15_nb600-501) Dab2 (p96), 610465, BD Transduction Laboratories (https://www.bdbiosciences.com/en-au/products/reagents/microscopy-imagingreagents/immunofluorescence-reagents/purified-mouse-anti-disabled-2-p96.610465) Dab2 (EP2297Y), ab76253, Abcam (https://www.abcam.com/products/primary-antibodies/dab2-antibody-ep2297y-ab76253.html) Recombinant Rabbit IgG, monoclonal [EPR25A] - Isotype Control, ab172730, Abcam (https://www.abcam.com/en-tw/products/ primary-antibodies/rabbit-igg-monoclonal-epr25a-isotype-control-ab172730) HA-Tag (6E2), 2367S, Cell Signaling (https://www.cellsignal.com/products/primary-antibodies/ha-tag-6e2-mouse-mab/2367) p-AKT (Ser473), AP0637, ABclonal (https://abclonal.com/catalog-antibodies/Phospho-Akt1-S473mAb/AP0637) AKT (pan) (C67E7), 4691X, Cell Signaling (https://www.cellsignal.com/products/primary-antibodies/akt-pan-c67e7-rabbit-mab/4691) AKT (pan) (40D4), 2920S, Cell Signaling (https://www.cellsignal.com/products/primary-antibodies/akt-pan-40d4-mouse-mab/2920) p-mTOR (Ser2481), 2974S, Cell Signaling (https://www.cellsignal.com/products/primary-antibodies/phospho-mtor-ser2481antibody/2974) Total mTOR, 2972S, Cell Signaling (https://www.cellsignal.com/products/primary-antibodies/mtor-antibody/2972) p-PLD1 (Thr147), 3831S, Cell Signaling (https://www.cellsignal.com/products/primary-antibodies/phospho-pld1-thr147antibody/3831) Total PLD1, 3832, Cell Signaling (https://www.cellsignal.com/products/primary-antibodies/pld1-antibody/3832) GST (B-14), sc-138, Santa Cruz Biotechnology (https://www.scbt.com/p/gst-antibody-b-14) Antibodies for flow cytometry: PE-conjugated anti-CD62P antibody (Psel.KO2.3), 12-0626-82, eBioscience (https://www.thermofisher.com/antibody/product/ CD62P-P-Selectin-Antibody-clone-Psel-KO2-3-Monoclonal/12-0626-82) PE-conjugated mouse IgG1 kappa Isotype Control (P3.6.2.8.1), 12-4714-82, eBioscience (https://www.thermofisher.com/antibody/ product/Mouse-IgG1-kappa-clone-P3-6-2-8-1-Monoclonal/12-4714-82) Alexa Fluor 488-conjugated fibrinogen, F13191, Invitrogen (https://www.thermofisher.com/order/catalog/product/F13191) FITC-conjugated anti-TP receptor antibody, 10012559, Cayman Chemicals Co. (https://www.caymanchem.com/product/10012559/ 4 n atu re p o rtfo lio | rep o rtin g su m m ary A pril2023 Animals and other research organisms Policy information about studies involving animals; ARRIVE guidelines recommended for reporting animal research, and Sex and Gender in Research Laboratory animals Wild animals Reporting on sex Field-collected samples Ethics oversight Note that full information on the approval of the study protocol must also be provided in the manuscript. ..

    Article Title: Human Disabled-2 regulates thromboxane A 2 signaling for efficient hemostasis in thrombocytopenia
    Article Snippet: .. Antibodies for Western blotting: (Antibody, Clone number (if applicable), Cat no, Supplier) Actin (AC-15), NB600-501, Novus Biologicals Dab2 (p96), 610465, BD Transduction Laboratories Dab2 (EP2297Y), ab76253, Abcam Recombinant Rabbit IgG, monoclonal [EPR25A] - Isotype Control, ab172730, Abcam HA-Tag (6E2), 2367S, Cell Signaling p-AKT (Ser473), AP0637, ABclonal AKT (pan) (C67E7), 4691X, Cell Signaling AKT (pan) (40D4), 2920S, Cell Signaling p-mTOR (Ser2481), 2974S, Cell Signaling Total mTOR, 2972S, Cell Signaling p-PLD1 (Thr147), 3831S, Cell Signaling Total PLD1, 3832, Cell Signaling GST (B-14), sc-138, Santa Cruz Biotechnology Antibodies for flow cytometry: (Antibody, Clone number (if applicable), Cat no, Supplier) PE-conjugated anti-CD62P antibody (Psel.KO2.3), 12-0626-82, eBioscience PE-conjugated mouse IgG1 kappa Isotype Control (P3.6.2.8.1), 12-4714-82, eBioscience Alexa Fluor 488-conjugated fibrinogen, F13191, Invitrogen FITC-conjugated anti-TP receptor antibody, 10012559, Cayman Chemicals Co. FITC-conjugated Normal Rabbit IgG, 10010322, Cayman Chemicals Co. All antibodies used in this study are commercially available and were validated by the manufacturer. ..



    Similar Products

    akt  (Cell Signaling Technology Inc)
    96
    Cell Signaling Technology Inc akt
    PC capsules promoted diabetes skin wound healing via <t>activating</t> <t>PI3K/AKT</t> signaling pathway: (A) top 20 KEGG pathway (signal transduction) analysis of differential genes between control group and PC capsule treatment group; (B) gene set enrichment analysis of regulated gene pathways with KEGG and Genomes databases; (C–E) IHC results showing increase in expression of p-PI3K in PC capsule group. Data are presented as mean ± standard deviation (SD) with n = 3 independent biological replicates per group. Statistical analysis was performed using one-way ANOVA followed by Tukey's post-hoc test. Significance markers are defined as: #p < 0.05 (vs control group); ∗p < 0.05, ∗∗p < 0.01 (vs PC group).
    Akt, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/2920s/Akt+(pan)+Mouse+mAb/pmc13022637-139-33-35
    Average 96 stars, based on 1 article reviews
    akt - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    mouse  (Cell Signaling Technology Inc)
    96
    Cell Signaling Technology Inc mouse
    PC capsules promoted diabetes skin wound healing via <t>activating</t> <t>PI3K/AKT</t> signaling pathway: (A) top 20 KEGG pathway (signal transduction) analysis of differential genes between control group and PC capsule treatment group; (B) gene set enrichment analysis of regulated gene pathways with KEGG and Genomes databases; (C–E) IHC results showing increase in expression of p-PI3K in PC capsule group. Data are presented as mean ± standard deviation (SD) with n = 3 independent biological replicates per group. Statistical analysis was performed using one-way ANOVA followed by Tukey's post-hoc test. Significance markers are defined as: #p < 0.05 (vs control group); ∗p < 0.05, ∗∗p < 0.01 (vs PC group).
    Mouse, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/2920s/Akt+(pan)+Mouse+mAb/pmc13049958-17-4-6
    Average 96 stars, based on 1 article reviews
    mouse - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    micromeritics autochem ii 2920 gas adsorption instrument  (Micromeritics Instrument)
    96
    Micromeritics Instrument micromeritics autochem ii 2920 gas adsorption instrument
    PC capsules promoted diabetes skin wound healing via <t>activating</t> <t>PI3K/AKT</t> signaling pathway: (A) top 20 KEGG pathway (signal transduction) analysis of differential genes between control group and PC capsule treatment group; (B) gene set enrichment analysis of regulated gene pathways with KEGG and Genomes databases; (C–E) IHC results showing increase in expression of p-PI3K in PC capsule group. Data are presented as mean ± standard deviation (SD) with n = 3 independent biological replicates per group. Statistical analysis was performed using one-way ANOVA followed by Tukey's post-hoc test. Significance markers are defined as: #p < 0.05 (vs control group); ∗p < 0.05, ∗∗p < 0.01 (vs PC group).
    Micromeritics Autochem Ii 2920 Gas Adsorption Instrument, supplied by Micromeritics Instrument, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/2920s/AutoChem/10__3390_slash_reactions7020025-199-14-21
    Average 96 stars, based on 1 article reviews
    micromeritics autochem ii 2920 gas adsorption instrument - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    primary antibodies pan akt  (Cell Signaling Technology Inc)
    96
    Cell Signaling Technology Inc primary antibodies pan akt
    PC capsules promoted diabetes skin wound healing via <t>activating</t> <t>PI3K/AKT</t> signaling pathway: (A) top 20 KEGG pathway (signal transduction) analysis of differential genes between control group and PC capsule treatment group; (B) gene set enrichment analysis of regulated gene pathways with KEGG and Genomes databases; (C–E) IHC results showing increase in expression of p-PI3K in PC capsule group. Data are presented as mean ± standard deviation (SD) with n = 3 independent biological replicates per group. Statistical analysis was performed using one-way ANOVA followed by Tukey's post-hoc test. Significance markers are defined as: #p < 0.05 (vs control group); ∗p < 0.05, ∗∗p < 0.01 (vs PC group).
    Primary Antibodies Pan Akt, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/2920s/Akt+(pan)+Mouse+mAb/pmc12993322-359-4-7
    Average 96 stars, based on 1 article reviews
    primary antibodies pan akt - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    micromeritics autochem ii 2920 chemisorption analyzer  (Micromeritics Instrument)
    96
    Micromeritics Instrument micromeritics autochem ii 2920 chemisorption analyzer
    PC capsules promoted diabetes skin wound healing via <t>activating</t> <t>PI3K/AKT</t> signaling pathway: (A) top 20 KEGG pathway (signal transduction) analysis of differential genes between control group and PC capsule treatment group; (B) gene set enrichment analysis of regulated gene pathways with KEGG and Genomes databases; (C–E) IHC results showing increase in expression of p-PI3K in PC capsule group. Data are presented as mean ± standard deviation (SD) with n = 3 independent biological replicates per group. Statistical analysis was performed using one-way ANOVA followed by Tukey's post-hoc test. Significance markers are defined as: #p < 0.05 (vs control group); ∗p < 0.05, ∗∗p < 0.01 (vs PC group).
    Micromeritics Autochem Ii 2920 Chemisorption Analyzer, supplied by Micromeritics Instrument, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/2920s/AutoChem/10__1016_slash_j__jece__2026__122549-75-7-13
    Average 96 stars, based on 1 article reviews
    micromeritics autochem ii 2920 chemisorption analyzer - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    phospho akt thr308  (Cell Signaling Technology Inc)
    96
    Cell Signaling Technology Inc phospho akt thr308
    PC capsules promoted diabetes skin wound healing via <t>activating</t> <t>PI3K/AKT</t> signaling pathway: (A) top 20 KEGG pathway (signal transduction) analysis of differential genes between control group and PC capsule treatment group; (B) gene set enrichment analysis of regulated gene pathways with KEGG and Genomes databases; (C–E) IHC results showing increase in expression of p-PI3K in PC capsule group. Data are presented as mean ± standard deviation (SD) with n = 3 independent biological replicates per group. Statistical analysis was performed using one-way ANOVA followed by Tukey's post-hoc test. Significance markers are defined as: #p < 0.05 (vs control group); ∗p < 0.05, ∗∗p < 0.01 (vs PC group).
    Phospho Akt Thr308, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/2920s/Akt+(pan)+Mouse+mAb/pmc12993322-359-12-14
    Average 96 stars, based on 1 article reviews
    phospho akt thr308 - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    rabbit anti phospho p44 42 mapk thr202 tyr204  (Cell Signaling Technology Inc)
    96
    Cell Signaling Technology Inc rabbit anti phospho p44 42 mapk thr202 tyr204
    PC capsules promoted diabetes skin wound healing via <t>activating</t> <t>PI3K/AKT</t> signaling pathway: (A) top 20 KEGG pathway (signal transduction) analysis of differential genes between control group and PC capsule treatment group; (B) gene set enrichment analysis of regulated gene pathways with KEGG and Genomes databases; (C–E) IHC results showing increase in expression of p-PI3K in PC capsule group. Data are presented as mean ± standard deviation (SD) with n = 3 independent biological replicates per group. Statistical analysis was performed using one-way ANOVA followed by Tukey's post-hoc test. Significance markers are defined as: #p < 0.05 (vs control group); ∗p < 0.05, ∗∗p < 0.01 (vs PC group).
    Rabbit Anti Phospho P44 42 Mapk Thr202 Tyr204, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/2920s/Akt+(pan)+Mouse+mAb/bio_rxiv__64898__2026__03__17__712321-240-17-21
    Average 96 stars, based on 1 article reviews
    rabbit anti phospho p44 42 mapk thr202 tyr204 - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    anti akt 40d4  (Cell Signaling Technology Inc)
    96
    Cell Signaling Technology Inc anti akt 40d4
    PC capsules promoted diabetes skin wound healing via <t>activating</t> <t>PI3K/AKT</t> signaling pathway: (A) top 20 KEGG pathway (signal transduction) analysis of differential genes between control group and PC capsule treatment group; (B) gene set enrichment analysis of regulated gene pathways with KEGG and Genomes databases; (C–E) IHC results showing increase in expression of p-PI3K in PC capsule group. Data are presented as mean ± standard deviation (SD) with n = 3 independent biological replicates per group. Statistical analysis was performed using one-way ANOVA followed by Tukey's post-hoc test. Significance markers are defined as: #p < 0.05 (vs control group); ∗p < 0.05, ∗∗p < 0.01 (vs PC group).
    Anti Akt 40d4, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/2920s/Akt+(pan)+Mouse+mAb/pm41828568-171-40-43
    Average 96 stars, based on 1 article reviews
    anti akt 40d4 - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    autochem 2920  (Micromeritics Instrument)
    96
    Micromeritics Instrument autochem 2920
    PC capsules promoted diabetes skin wound healing via <t>activating</t> <t>PI3K/AKT</t> signaling pathway: (A) top 20 KEGG pathway (signal transduction) analysis of differential genes between control group and PC capsule treatment group; (B) gene set enrichment analysis of regulated gene pathways with KEGG and Genomes databases; (C–E) IHC results showing increase in expression of p-PI3K in PC capsule group. Data are presented as mean ± standard deviation (SD) with n = 3 independent biological replicates per group. Statistical analysis was performed using one-way ANOVA followed by Tukey's post-hoc test. Significance markers are defined as: #p < 0.05 (vs control group); ∗p < 0.05, ∗∗p < 0.01 (vs PC group).
    Autochem 2920, supplied by Micromeritics Instrument, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/2920s/AutoChem/pmc13096657-227-16-19
    Average 96 stars, based on 1 article reviews
    autochem 2920 - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier

    Image Search Results


    PC capsules promoted diabetes skin wound healing via activating PI3K/AKT signaling pathway: (A) top 20 KEGG pathway (signal transduction) analysis of differential genes between control group and PC capsule treatment group; (B) gene set enrichment analysis of regulated gene pathways with KEGG and Genomes databases; (C–E) IHC results showing increase in expression of p-PI3K in PC capsule group. Data are presented as mean ± standard deviation (SD) with n = 3 independent biological replicates per group. Statistical analysis was performed using one-way ANOVA followed by Tukey's post-hoc test. Significance markers are defined as: #p < 0.05 (vs control group); ∗p < 0.05, ∗∗p < 0.01 (vs PC group).

    Journal: Materials Today Bio

    Article Title: Procyanidin capsules attenuate PI3K/AKT-mediated mitochondrial dysfunction and accelerate skin wound healing in diabetic mice

    doi: 10.1016/j.mtbio.2026.103029

    Figure Lengend Snippet: PC capsules promoted diabetes skin wound healing via activating PI3K/AKT signaling pathway: (A) top 20 KEGG pathway (signal transduction) analysis of differential genes between control group and PC capsule treatment group; (B) gene set enrichment analysis of regulated gene pathways with KEGG and Genomes databases; (C–E) IHC results showing increase in expression of p-PI3K in PC capsule group. Data are presented as mean ± standard deviation (SD) with n = 3 independent biological replicates per group. Statistical analysis was performed using one-way ANOVA followed by Tukey's post-hoc test. Significance markers are defined as: #p < 0.05 (vs control group); ∗p < 0.05, ∗∗p < 0.01 (vs PC group).

    Article Snippet: After blocking (5% skim milk/bovine serum albumin, 1.5 h), the membranes were incubated overnight at 4 °C with the primary antibodies against p-AKT (#4060, CST, USA; 1:1000), p-PI3K (#AF3241, Affinity, China; 1:1000), total AKT (#2920, CST, USA; 1:1000), and PI3K (#4249, CST, USA; 1:1000).

    Techniques: Capsules, Transduction, Control, Expressing, Standard Deviation

    PC capsule–mediated cytoprotection via promoting activation of PI3K/AKT signaling pathway: expression of p-PI3K, PI3K, p-AKT, and AKT in HUVECs treated with PC capsules for 24 h and presence/absence of H 2 O 2 for 6 h (A); and analysis of optical density values of p-PI3K/PI3K (B) and p-AKT/AKT (C); expression of p-PI3K, PI3K, p-AKT, and AKT in NIH/3T3 cells treated with PC capsules for 24 h and presence/absence of H 2 O 2 for 6 h (D); and analysis of optical density values of p-PI3K/PI3K (E) and p-AKT/AKT (F). Data are presented as mean ± standard deviation (SD) with n = 3 independent biological replicates per group. Statistical analysis was performed using one-way ANOVA followed by Tukey's post-hoc test. Significance markers are defined as: #p < 0.05, ##p < 0.01, ###p < 0.001 (vs control group); ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001 (vs PC group or vs H 2 O 2 group).

    Journal: Materials Today Bio

    Article Title: Procyanidin capsules attenuate PI3K/AKT-mediated mitochondrial dysfunction and accelerate skin wound healing in diabetic mice

    doi: 10.1016/j.mtbio.2026.103029

    Figure Lengend Snippet: PC capsule–mediated cytoprotection via promoting activation of PI3K/AKT signaling pathway: expression of p-PI3K, PI3K, p-AKT, and AKT in HUVECs treated with PC capsules for 24 h and presence/absence of H 2 O 2 for 6 h (A); and analysis of optical density values of p-PI3K/PI3K (B) and p-AKT/AKT (C); expression of p-PI3K, PI3K, p-AKT, and AKT in NIH/3T3 cells treated with PC capsules for 24 h and presence/absence of H 2 O 2 for 6 h (D); and analysis of optical density values of p-PI3K/PI3K (E) and p-AKT/AKT (F). Data are presented as mean ± standard deviation (SD) with n = 3 independent biological replicates per group. Statistical analysis was performed using one-way ANOVA followed by Tukey's post-hoc test. Significance markers are defined as: #p < 0.05, ##p < 0.01, ###p < 0.001 (vs control group); ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001 (vs PC group or vs H 2 O 2 group).

    Article Snippet: After blocking (5% skim milk/bovine serum albumin, 1.5 h), the membranes were incubated overnight at 4 °C with the primary antibodies against p-AKT (#4060, CST, USA; 1:1000), p-PI3K (#AF3241, Affinity, China; 1:1000), total AKT (#2920, CST, USA; 1:1000), and PI3K (#4249, CST, USA; 1:1000).

    Techniques: Activation Assay, Expressing, Capsules, Standard Deviation, Control

    PC capsules improve HUVEC and NIH/3T3 cell dysfunction by regulating PI3K/AKT signaling. HUVECs and NIH/3T3 cells were treated with PC capsules and LY294002 for 24 h and H 2 O 2 for 6 h. (A) Images of HUVEC migration exposure to H 2 O 2 , LY294002, PC capsules after 24 h; (B) quantification of percentage wound area remaining for HUVECs; (C) images of NIH/3T3 cell migration exposure to H 2 O 2 , LY294002, PC capsules after 24 h; (D) quantification of percentage wound area remaining for NIH/3T3 cells; (E–F) digital images of endothelial cell microtubule formation after treatment with H 2 O 2 , LY294002, and PC capsules. Quantification of (G) number of branch sites, (H) total lengths and (I) numbers of tube nodes (J); and analysis of optical density values of p-PI3K/PI3K (K) and p-AKT/AKT (L); expression of p-PI3K, PI3K, p-AKT, and AKT in NIH/3T3 cells treated with PC capsules, and LY294002 for 24 h and presence/absence of H 2 O 2 for 6 h (M); and analysis of optical density values of p-PI3K/PI3K (N) and p-AKT/AKT (O). Data are presented as mean ± standard deviation (SD) with n = 3 independent biological replicates per group. Statistical analysis was performed using one-way ANOVA followed by Tukey's post-hoc test. Significance markers are defined as: ##p < 0.01, ###p < 0.001 (vs. control group); ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001 (vs PC group or vs LY294002 group).

    Journal: Materials Today Bio

    Article Title: Procyanidin capsules attenuate PI3K/AKT-mediated mitochondrial dysfunction and accelerate skin wound healing in diabetic mice

    doi: 10.1016/j.mtbio.2026.103029

    Figure Lengend Snippet: PC capsules improve HUVEC and NIH/3T3 cell dysfunction by regulating PI3K/AKT signaling. HUVECs and NIH/3T3 cells were treated with PC capsules and LY294002 for 24 h and H 2 O 2 for 6 h. (A) Images of HUVEC migration exposure to H 2 O 2 , LY294002, PC capsules after 24 h; (B) quantification of percentage wound area remaining for HUVECs; (C) images of NIH/3T3 cell migration exposure to H 2 O 2 , LY294002, PC capsules after 24 h; (D) quantification of percentage wound area remaining for NIH/3T3 cells; (E–F) digital images of endothelial cell microtubule formation after treatment with H 2 O 2 , LY294002, and PC capsules. Quantification of (G) number of branch sites, (H) total lengths and (I) numbers of tube nodes (J); and analysis of optical density values of p-PI3K/PI3K (K) and p-AKT/AKT (L); expression of p-PI3K, PI3K, p-AKT, and AKT in NIH/3T3 cells treated with PC capsules, and LY294002 for 24 h and presence/absence of H 2 O 2 for 6 h (M); and analysis of optical density values of p-PI3K/PI3K (N) and p-AKT/AKT (O). Data are presented as mean ± standard deviation (SD) with n = 3 independent biological replicates per group. Statistical analysis was performed using one-way ANOVA followed by Tukey's post-hoc test. Significance markers are defined as: ##p < 0.01, ###p < 0.001 (vs. control group); ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001 (vs PC group or vs LY294002 group).

    Article Snippet: After blocking (5% skim milk/bovine serum albumin, 1.5 h), the membranes were incubated overnight at 4 °C with the primary antibodies against p-AKT (#4060, CST, USA; 1:1000), p-PI3K (#AF3241, Affinity, China; 1:1000), total AKT (#2920, CST, USA; 1:1000), and PI3K (#4249, CST, USA; 1:1000).

    Techniques: Capsules, Migration, Expressing, Standard Deviation, Control